STM Article Repository

The Groundnut bud necrosis virus in tomato (GBNV-To) was maintained on cowpea cv. C-152 in the laboratory. Cowpea was selected as an assay host for the maintenance of the virus, since it has consistently produced more local lesions within four to five days after inoculation. The virus isolates were further confirmed by DAC (Direct antigen coating)-ELISA. Twelve samples have shown positive reaction under DAC-ELISA and the OD values were recorded at 405 nm from the infected and healthy plants. Out of the these 12 isolates, six isolates representing one each from Kurnool, Kadapa, Chittoor, Guntur, Nizamabad and Godavari were selected for molecular detection. Total RNA was isolated from the six virus isolates by triazol method using plant RNA easy isolation kit (Qiagen). The purity and integrity of the isolated RNA was checked on denatured agarose gel electrophoresis in TBE (Tris-Borate-EDTA) buffer system. The RNA of six isolates from Kurnool, Kadapa, Chittoor, Guntur, Godavari and Nizamabad districts were subjected to reverse transcription–polymerase chain reaction (RT–PCR) amplification using CP gene primers. The genome sense primer, 50-ATGTCTAACGT(C/T) AAGCA (A/G) CTC-30 and antisense primer, 50- TTACAATTCCAGCGAAGGACC 30 were used to amplify the complete CP gene (size*800bp) of GBNV [1]. Amplified products were resolved by electrophoresis through a 1% agarose gel containing ethidium bromide. Agarose gel electrophoresis of DNA was performed as described by Sambrook et al., (1989). Among six isolates, the nucleocapsid protein (N) gene of isolates, such as tomato isolate Kurnool, tomato-isolate Chittoor, tomato-isolate Guntur, tomato-isolate Godavari and tomato-isolate Nizamabad were amplified. The primers were selectively amplified approximately 830 bp products in RT–PCR. The 830-bp cDNA band of the above three positive GBNV-To isolates were gel eluted, purified and ligated into TA cloning (pTZ57R/T) vector (Fermantas) and transformed into competent Escherichia coli cells (DH5a) and plated on ampicillin. X-gal and IPTG (Isopropyl-b thiogaloctopyranoside) containing LB (Luria-Bertani) medium was incubated at 37°C for overnight. The recombinant amino acid levels with available sequences of GBNV in Gen Bank using BIO-EDIT and MEGA software. The sequence has been deposited in NCBI Gen bank (Acc.No.HM 195249). The N gene was compared with that of the other known Tospoviruses recorded in India. Cluster dendrogram revealed that the tomato Tospovirus from Kurnool district was most closely related to GBNV forming one cluster. Comparative sequence analyses showed that the tomato Tospovirus shared maximum sequence identity with GBNV at nucleotide (93–99%) as well as amino acid (93%) levels. The nucleotide and amino acid sequence identities were observed with N genes of other Tospoviruses. A close sequence relationship between the N genes of the tomato Tospovirus and GBNV was in agreement with the serological data. In the present studies it is determined that the GBNV-To isolate of tomato prevalent in A.P is regarded as the same strain of GBNV already existing in India.